human pp2a catalytic subunit Search Results


94
Bio-Techne corporation human mouse rat phospho pp2a catalytic subunit antibody
The phosphorylation of PP2Ac, not the total level of PP2Ac, was affected by the expression of MID1/MID2. The total cellular PP2Ac and phosphor-PP2Ac 307 were determined by immunoblotting in cells overexpressing MID1/MID2 or in cells with siRNA mediated knock-down of MID1/MID2 (A and C). The relative expression of PP2Ac and p-PP2Ac were quantified by scanning densitometry and normalized with respect to total β-catenin (B and D). Graphs represent the average of 3 independent experiments (mean ± SEM; student t-test; *, P<0.05, **, P<0.01, ****, P<0.0001). It was observed that the phosphorylated PP2Ac was significantly increased in cells overexpressing MID1/MID2 and decreased in cells with MID1/MID2 gene silencing, while the change of the cellular level of total <t>PP2A</t> was unnoticed.
Human Mouse Rat Phospho Pp2a Catalytic Subunit Antibody, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human mouse rat phospho pp2a catalytic subunit antibody/product/Bio-Techne corporation
Average 94 stars, based on 1 article reviews
human mouse rat phospho pp2a catalytic subunit antibody - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

94
R&D Systems pp2a
Immunostaining for <t>PP2A</t> and PP2B in rat kidney inner medullas. A: rat inner medullas were harvested from untreated control rats and analyzed by Western blot for PP2A (36 kDa, left) and PP2B (calcineurin B, 19 kDa, right), with each protein being identified with an arrow. Shown are IM tissue samples from 4 individual rats. B: representative images (original magnification ×400) of immunostaining of rat inner medulla in paraffin sections from perfusion-fixed control rat kidney stained antibody to PP2A (left) and PP2B (right) and visualized with DAPA as described in materials and methods. Collecting duct lumens are identified by “L.” C: negative staining using secondary antibody only and developed with the slides that received both primary and secondary antibody.
Pp2a, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pp2a/product/R&D Systems
Average 94 stars, based on 1 article reviews
pp2a - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
OriGene human pp2ac
Overexpression of <t>PP2Ac</t> activates JAK3/STAT5 signaling in human Tregs. Expanded human Tregs were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and cultured in SFM with anti-CD3/CD28 beads and IL-2 for 3 days before analysis. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B-D) Expression of PP2Ac in GFP+ cells was assessed at the mRNA and protein levels using qPCR (B), Western blotting (C), and flow cytometry (D) (n=3). (E) A representative immunoblot (left) and densitometry analysis of the resulting data (right) of protein extracts from transduced Tregs were probed for tyrosine-phosphorylated JAK3 (Tyr980/981), total JAK3, tyrosine-phosphorylated STAT5 (Tyr694), PP2Ac, and β-Tubulin (n=3). (F) IL-2-induced pSTAT5 dose-response curves of transduced Tregs (GFP+Foxp3+) (left) and nonlinear regression analysis of the binding data (middle) to determine EC50 (right) for IL-2-induced pSTAT5 activation (n=6). Data in plots are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B-F). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant.
Human Pp2ac, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human pp2ac/product/OriGene
Average 90 stars, based on 1 article reviews
human pp2ac - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
OriGene human pp2a catalytic subunit
Effect of okadaic acid (OA; 10 −9 M) on corticosteroid sensitivity (A), GR nuclear translocation (B), phosphorylation levels of GR-Ser 226 (C) and JNK1 (D) in U937 cells (n = 3–4). E: Effect of <t>PP2A</t> siRNA on IC 50 of dexamethasone on TNFα-induced IL-8 (n = 7). Values represent means ± SEM. # P <0.05, ## P <0.01 (vs. non-treatment control; NT), * P <0.05.
Human Pp2a Catalytic Subunit, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human pp2a catalytic subunit/product/OriGene
Average 90 stars, based on 1 article reviews
human pp2a catalytic subunit - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

86
R&D Systems monoclonal rat anti human pp2a
SP-induced association of NK1R, β-arrestin-1 (βARR1), and protein <t>phosphatase</t> <t>2A</t> <t>(PP2A).</t> A and B: HEK-NK1R cells transfected with βARR1-green fluorescent protein (GFP) and hemagglutinin (HA)-PP2A were incubated with SP (10 nM, 0–10 min). SP induced redistribution of βARR1-GFP and HA-PP2A from the cytosol (arrows) to the plasma membrane (arrowheads) (A). Quantification indicated that SP significantly increased plasma membrane βARR1 and PP2A (B). C: HEK-NK1R cells were incubated with SP. Endogenous PP2A was immunoprecipitated (IP) and Western blotted (WB) for endogenous βARR1. D and E: HEK-NK1R cells were incubated with SP (10 nM, 0–10 min), and association of NK1R with endogenous βARR1 or PP2A was determined by proximity ligation assay (PLA). The total number of PLA signals (red) was divided by the number of nuclei (blue) to calculate PLA signals per cell. SP significantly increased PLA signals for NK1R with βARR1 and PP2A. F and G: controls for PLA. Cells were incubated with SP (10 nM, 10 min), and association of NK1R with endogenous βARR1 or PP2A was determined by PLA. In HEK-NK1R cells (F), there were no detected PLA signals when primary antibodies were omitted. In HEK-FLP cells lacking NK1R (G), there were no PLA signals for NK1R and βARR1 (top) nor NK1R and PP2A (bottom). Scale, 10 μm. (n = 3–5 experiments, >10 images analyzed per experiment.) *P < 0.05.
Monoclonal Rat Anti Human Pp2a, supplied by R&D Systems, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/monoclonal rat anti human pp2a/product/R&D Systems
Average 86 stars, based on 1 article reviews
monoclonal rat anti human pp2a - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

93
R&D Systems anti pp2ac
S100A8/A9 proteins augment differentiation and osteoclastic activity derived from iOCPs but not from hOCPs. a Expression of S100A8, S100A9 and RAGE in sorted control and inflamed BM iOCPs and hOCPs. The protein phosphatase 2A catalytic subunit <t>(PP2Ac)</t> is shown as a loading control. b Densitometry measurements of three biological repeats (no statistical analysis presented). c Sorted control and inflamed BM iOCPs and hOCPs (5 × 10 4 ) were cultured on the Osteo assay surface with or without anti-RAGE blocking antibodies (bar: 50 µm). d Pit area quantitation. e Sorted iOCPs and hOCPs (5 × 10 4 ) from the BM of control mice were cultured on the Osteo assay surface in combination with a recombinant S100A8/A9 heterodimer and anti-RAGE blocking antibodies as indicated (bar: 50 µm). f Pit area quantitation. c – f Depict representative results for two independent experiments, n = 5 for each group. Line: median, box: 25th-75th percentile, whiskers: range. * P < 0.05 (Mann–Whitney test and Holm multiplicity correction)
Anti Pp2ac, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti pp2ac/product/R&D Systems
Average 93 stars, based on 1 article reviews
anti pp2ac - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


The phosphorylation of PP2Ac, not the total level of PP2Ac, was affected by the expression of MID1/MID2. The total cellular PP2Ac and phosphor-PP2Ac 307 were determined by immunoblotting in cells overexpressing MID1/MID2 or in cells with siRNA mediated knock-down of MID1/MID2 (A and C). The relative expression of PP2Ac and p-PP2Ac were quantified by scanning densitometry and normalized with respect to total β-catenin (B and D). Graphs represent the average of 3 independent experiments (mean ± SEM; student t-test; *, P<0.05, **, P<0.01, ****, P<0.0001). It was observed that the phosphorylated PP2Ac was significantly increased in cells overexpressing MID1/MID2 and decreased in cells with MID1/MID2 gene silencing, while the change of the cellular level of total PP2A was unnoticed.

Journal: Annals of Translational Medicine

Article Title: MID1 and MID2 regulate cell migration and epithelial-mesenchymal transition via modulating Wnt/β-catenin signaling

doi: 10.21037/atm-20-5583

Figure Lengend Snippet: The phosphorylation of PP2Ac, not the total level of PP2Ac, was affected by the expression of MID1/MID2. The total cellular PP2Ac and phosphor-PP2Ac 307 were determined by immunoblotting in cells overexpressing MID1/MID2 or in cells with siRNA mediated knock-down of MID1/MID2 (A and C). The relative expression of PP2Ac and p-PP2Ac were quantified by scanning densitometry and normalized with respect to total β-catenin (B and D). Graphs represent the average of 3 independent experiments (mean ± SEM; student t-test; *, P<0.05, **, P<0.01, ****, P<0.0001). It was observed that the phosphorylated PP2Ac was significantly increased in cells overexpressing MID1/MID2 and decreased in cells with MID1/MID2 gene silencing, while the change of the cellular level of total PP2A was unnoticed.

Article Snippet: PP2Ac Subunit Rabbit mAb (cat. no. 2259; 1:1,000), β-Actin Mouse mAb (cat. no. 3700; 1:1,000), E-cadherin rabbit mAb (cat. no. #3195, 1:100), Vimentin XP ® Rabbit mAb (cat. no. #5741, 1:200) were purchased from Cell Signaling Technology, Inc. Human/Mouse/Rat Phospho-PP2A Catalytic Subunit Antibody (cat. no. AF3989, 1:500) was from Bio-Techne Ltd (Abingdon, UK), HRP-conjugated Goat Anti-Mouse IgG (H+L) (cat. no. SA00001-1; 1:1,000), HRP-conjugated Donkey Anti-Goat IgG (H+L) (cat. no. SA00003-1; 1:3,000) and HRP-conjugated Goat Anti-Rabbit IgG (H+L) (cat. no. SA00001-2; 1:3,000) were purchased from Proteintech (Chicago, Ill., USA).

Techniques: Expressing, Western Blot, Knockdown

MID1/MID2 regulate Wnt signaling via their influence on PP2A’s enzyme activity. The expression of β-catenin were examined by immunoblotting in cells overexpressing MID1/MID2 or in cells with siRNA mediated knock-down of MID1/MID2, followed by quantification using scanning densitometry and shown as the average of 3 independent experiments (mean ± SEM; student t-test; *, P<0.05, **, P<0.01, ****, P<0.0001). In addition, the Wnt signaling monitored using Tcf/Lef luciferase reporter assay. The cells were transfected with pTOP/FOP-FLASH and the constitutively active vector encoding for Renilla luciferase, with MID1/MID2 expressing vector or MID1/MID2 siRNA. After 24 h, cells were homogenize and prepared for luciferase reporter assay. Data were obtained as the ratio luciferase/renilla activity, presented as relative values with respect to control cells transfected with empty vector or nonsense siRNA. Results were recorded as the means of triplicates and averaged from 3 independent experiments. (A) β-catenin levels were analyzed by Western blotting with specific antibody in cells transfected with siMID1/siMID2. (B) Knock-down of MID1/MID2 expression significantly increased β-catenin. (C) β-catenin levels were analyzed by Western blotting in cells transfected with pcDNA-MID1/pcDNA-MID2. (D) Overexpressing MID1/MID2 significantly decreased β-catenin. (E) The Wnt signaling was attenuated in cells overexpressing MID1/MID2, while was enhanced in cells with MID1/MID2 gene silencing. The compromised Wnt signaling in cells treated with Okadaic acid, a specific PP2A inhibitor, and was partially recovered by MID1/MID2 gene silencing.

Journal: Annals of Translational Medicine

Article Title: MID1 and MID2 regulate cell migration and epithelial-mesenchymal transition via modulating Wnt/β-catenin signaling

doi: 10.21037/atm-20-5583

Figure Lengend Snippet: MID1/MID2 regulate Wnt signaling via their influence on PP2A’s enzyme activity. The expression of β-catenin were examined by immunoblotting in cells overexpressing MID1/MID2 or in cells with siRNA mediated knock-down of MID1/MID2, followed by quantification using scanning densitometry and shown as the average of 3 independent experiments (mean ± SEM; student t-test; *, P<0.05, **, P<0.01, ****, P<0.0001). In addition, the Wnt signaling monitored using Tcf/Lef luciferase reporter assay. The cells were transfected with pTOP/FOP-FLASH and the constitutively active vector encoding for Renilla luciferase, with MID1/MID2 expressing vector or MID1/MID2 siRNA. After 24 h, cells were homogenize and prepared for luciferase reporter assay. Data were obtained as the ratio luciferase/renilla activity, presented as relative values with respect to control cells transfected with empty vector or nonsense siRNA. Results were recorded as the means of triplicates and averaged from 3 independent experiments. (A) β-catenin levels were analyzed by Western blotting with specific antibody in cells transfected with siMID1/siMID2. (B) Knock-down of MID1/MID2 expression significantly increased β-catenin. (C) β-catenin levels were analyzed by Western blotting in cells transfected with pcDNA-MID1/pcDNA-MID2. (D) Overexpressing MID1/MID2 significantly decreased β-catenin. (E) The Wnt signaling was attenuated in cells overexpressing MID1/MID2, while was enhanced in cells with MID1/MID2 gene silencing. The compromised Wnt signaling in cells treated with Okadaic acid, a specific PP2A inhibitor, and was partially recovered by MID1/MID2 gene silencing.

Article Snippet: PP2Ac Subunit Rabbit mAb (cat. no. 2259; 1:1,000), β-Actin Mouse mAb (cat. no. 3700; 1:1,000), E-cadherin rabbit mAb (cat. no. #3195, 1:100), Vimentin XP ® Rabbit mAb (cat. no. #5741, 1:200) were purchased from Cell Signaling Technology, Inc. Human/Mouse/Rat Phospho-PP2A Catalytic Subunit Antibody (cat. no. AF3989, 1:500) was from Bio-Techne Ltd (Abingdon, UK), HRP-conjugated Goat Anti-Mouse IgG (H+L) (cat. no. SA00001-1; 1:1,000), HRP-conjugated Donkey Anti-Goat IgG (H+L) (cat. no. SA00003-1; 1:3,000) and HRP-conjugated Goat Anti-Rabbit IgG (H+L) (cat. no. SA00001-2; 1:3,000) were purchased from Proteintech (Chicago, Ill., USA).

Techniques: Activity Assay, Expressing, Western Blot, Knockdown, Luciferase, Reporter Assay, Transfection, Plasmid Preparation, Control

Immunostaining for PP2A and PP2B in rat kidney inner medullas. A: rat inner medullas were harvested from untreated control rats and analyzed by Western blot for PP2A (36 kDa, left) and PP2B (calcineurin B, 19 kDa, right), with each protein being identified with an arrow. Shown are IM tissue samples from 4 individual rats. B: representative images (original magnification ×400) of immunostaining of rat inner medulla in paraffin sections from perfusion-fixed control rat kidney stained antibody to PP2A (left) and PP2B (right) and visualized with DAPA as described in materials and methods. Collecting duct lumens are identified by “L.” C: negative staining using secondary antibody only and developed with the slides that received both primary and secondary antibody.

Journal: American Journal of Physiology - Renal Physiology

Article Title: Phosphatase inhibition increases AQP2 accumulation in the rat IMCD apical plasma membrane

doi: 10.1152/ajprenal.00150.2016

Figure Lengend Snippet: Immunostaining for PP2A and PP2B in rat kidney inner medullas. A: rat inner medullas were harvested from untreated control rats and analyzed by Western blot for PP2A (36 kDa, left) and PP2B (calcineurin B, 19 kDa, right), with each protein being identified with an arrow. Shown are IM tissue samples from 4 individual rats. B: representative images (original magnification ×400) of immunostaining of rat inner medulla in paraffin sections from perfusion-fixed control rat kidney stained antibody to PP2A (left) and PP2B (right) and visualized with DAPA as described in materials and methods. Collecting duct lumens are identified by “L.” C: negative staining using secondary antibody only and developed with the slides that received both primary and secondary antibody.

Article Snippet: PVDF membranes were blocked for 60 min with 5% nonfat dry milk before overnight incubation with primary antibodies: our total AQP2 ( 12 , 24 ), pS 256 -AQP2 (Biorbyt, Burlington, NC; catalog no. orb317557), pS 261 -AQP2 (Avivasysbio, San Diego, CA; catalog no. OAPC00158), pS 264 -AQP2 (Thermo Fisher Scientific, Norcross, GA; catalog no. PA5-35387), pS 269 -AQP2 (Thermo Fisher Scientific; catalog no. PA5-35388), PP2A (R & D Systems, Minneapolis, MN; catalog no. AF1653), and PP2B (R & D Systems; catalog no. AF1348).

Techniques: Immunostaining, Control, Western Blot, Staining, Negative Staining

Overexpression of PP2Ac activates JAK3/STAT5 signaling in human Tregs. Expanded human Tregs were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and cultured in SFM with anti-CD3/CD28 beads and IL-2 for 3 days before analysis. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B-D) Expression of PP2Ac in GFP+ cells was assessed at the mRNA and protein levels using qPCR (B), Western blotting (C), and flow cytometry (D) (n=3). (E) A representative immunoblot (left) and densitometry analysis of the resulting data (right) of protein extracts from transduced Tregs were probed for tyrosine-phosphorylated JAK3 (Tyr980/981), total JAK3, tyrosine-phosphorylated STAT5 (Tyr694), PP2Ac, and β-Tubulin (n=3). (F) IL-2-induced pSTAT5 dose-response curves of transduced Tregs (GFP+Foxp3+) (left) and nonlinear regression analysis of the binding data (middle) to determine EC50 (right) for IL-2-induced pSTAT5 activation (n=6). Data in plots are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B-F). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac activates JAK3/STAT5 signaling in human Tregs. Expanded human Tregs were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and cultured in SFM with anti-CD3/CD28 beads and IL-2 for 3 days before analysis. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B-D) Expression of PP2Ac in GFP+ cells was assessed at the mRNA and protein levels using qPCR (B), Western blotting (C), and flow cytometry (D) (n=3). (E) A representative immunoblot (left) and densitometry analysis of the resulting data (right) of protein extracts from transduced Tregs were probed for tyrosine-phosphorylated JAK3 (Tyr980/981), total JAK3, tyrosine-phosphorylated STAT5 (Tyr694), PP2Ac, and β-Tubulin (n=3). (F) IL-2-induced pSTAT5 dose-response curves of transduced Tregs (GFP+Foxp3+) (left) and nonlinear regression analysis of the binding data (middle) to determine EC50 (right) for IL-2-induced pSTAT5 activation (n=6). Data in plots are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B-F). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Transduction, Plasmid Preparation, Cell Culture, Expressing, Western Blot, Flow Cytometry, Binding Assay, Activation Assay, Two Tailed Test

Overexpression of PP2Ac upregulates IL-2-dependent genes in human Tregs. Tregs from different healthy adult donors (n=3) were expanded and lentiviral transduced in vitro. Total RNA was isolated from vector-transduced or PP2Ac-overexpressed Tregs 3 days after lentiviral transduction and analyzed by real-time qPCR. Data were normalized to the mRNA level in the control vector-transduced cells. The sample in each graph with the highest fold change is from the same donor.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac upregulates IL-2-dependent genes in human Tregs. Tregs from different healthy adult donors (n=3) were expanded and lentiviral transduced in vitro. Total RNA was isolated from vector-transduced or PP2Ac-overexpressed Tregs 3 days after lentiviral transduction and analyzed by real-time qPCR. Data were normalized to the mRNA level in the control vector-transduced cells. The sample in each graph with the highest fold change is from the same donor.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, In Vitro, Isolation, Plasmid Preparation, Transduction

Increased expression of CD25 induced by PP2Ac overexpression does not fully account for enhanced pSTAT5 activation. Expanded human Tregs from different healthy adult donors (n=4) were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and analyzed 3 days later. (A) CD25 level of Foxp3+ GFP+ transduced Tregs. Numbers represent MFI of CD25 for the indicated cell population. (B) Representative gating strategy of FACS plots to identify transduced Tregs with a similar MFI of CD25 (represented in the P5 gate). (C) IL-2-induced pSTAT5 dose-response curves (left) of control or PP2Ac-overexpressed Tregs with similar CD25 levels, as shown in Fig. 5B. Nonlinear regression analysis of the binding data (middle) was conducted to determine the EC50 (right) for IL-2-induced pSTAT5. (D) MFI of pSTAT5 vs. CD25 levels in control and PP2Ac-overexpressed Tregs after stimulation with IL-2 (1 unit/mL) for 15 min (n=4). Representative gating strategy (left) and quantified data (right) where the MFI of CD25 was normalized to 1 based for the gated cell with the lowest amount of CD25. Data (C, D) are shown as means ± SEM and were analyzed by one-sample two-tailed t test (C) or a paired two-tailed t test (D). *P < 0.05, **P < 0.01, ****P<0.0001.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Increased expression of CD25 induced by PP2Ac overexpression does not fully account for enhanced pSTAT5 activation. Expanded human Tregs from different healthy adult donors (n=4) were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and analyzed 3 days later. (A) CD25 level of Foxp3+ GFP+ transduced Tregs. Numbers represent MFI of CD25 for the indicated cell population. (B) Representative gating strategy of FACS plots to identify transduced Tregs with a similar MFI of CD25 (represented in the P5 gate). (C) IL-2-induced pSTAT5 dose-response curves (left) of control or PP2Ac-overexpressed Tregs with similar CD25 levels, as shown in Fig. 5B. Nonlinear regression analysis of the binding data (middle) was conducted to determine the EC50 (right) for IL-2-induced pSTAT5. (D) MFI of pSTAT5 vs. CD25 levels in control and PP2Ac-overexpressed Tregs after stimulation with IL-2 (1 unit/mL) for 15 min (n=4). Representative gating strategy (left) and quantified data (right) where the MFI of CD25 was normalized to 1 based for the gated cell with the lowest amount of CD25. Data (C, D) are shown as means ± SEM and were analyzed by one-sample two-tailed t test (C) or a paired two-tailed t test (D). *P < 0.05, **P < 0.01, ****P<0.0001.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Expressing, Over Expression, Activation Assay, Transduction, Plasmid Preparation, Binding Assay, Two Tailed Test

PP2Ac increases survival, activation, and immunosuppressive function of human Tregs. Representative histograms (A) and quantitative evaluation (B) of expression of the indicated markers for control and PP2Ac-overexpressed Tregs (n=4). (C) In vitro suppression assay of CD8+ T cells (responders) by control or PP2Ac-overexpressed Tregs (n=3). Data (B, C) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B) or an unpaired two-tailed t test (C).*P < 0.05, **P < 0.01, ***P<0.001, ns, not significant.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: PP2Ac increases survival, activation, and immunosuppressive function of human Tregs. Representative histograms (A) and quantitative evaluation (B) of expression of the indicated markers for control and PP2Ac-overexpressed Tregs (n=4). (C) In vitro suppression assay of CD8+ T cells (responders) by control or PP2Ac-overexpressed Tregs (n=3). Data (B, C) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B) or an unpaired two-tailed t test (C).*P < 0.05, **P < 0.01, ***P<0.001, ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Activation Assay, Expressing, In Vitro, Suppression Assay, Two Tailed Test

Knockdown of PP2Ac reduces pSTAT5 response to IL-2 by human Tregs. Expanded human Tregs were lentiviral transduced with control or PP2Ac shRNA and analyzed after 3 days. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B) Expression of PP2Ac was assessed by qPCR (n=3), western blotting (n=3), and flow cytometry (n=3) in control and PP2Ac knockdown Tregs. (C) FACS gating strategy for pSTAT5 activation analysis. Tregs transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency. Numbers represent MFI of PP2Ac for the indicated cell population. (D) IL-2-induced pSTAT5 dose-response curves (left) for the indicated group of Tregs shown in Fig. 7C (n=6). Nonlinear regression analysis of the binding data (middle) was used to determine EC50 (right) (E) Representative histograms (left) and quantitative evaluation (right) of pSTAT5 MFI for indicated cell population after treatment with 40 and 400 pM of IL-2 (n=6). The numbers represent MFI of the gated pSTAT5+ cells. (F) Representative histograms of IL-2R subunit expression on control and PP2Ac shRNA transduced Tregs. Data (B-E) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B, D-E) or an unpaired two-tailed t test (D).*P < 0.05, **P < 0.01, ***P<0.001, ****P<0.0001, ns, not significant;

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Knockdown of PP2Ac reduces pSTAT5 response to IL-2 by human Tregs. Expanded human Tregs were lentiviral transduced with control or PP2Ac shRNA and analyzed after 3 days. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B) Expression of PP2Ac was assessed by qPCR (n=3), western blotting (n=3), and flow cytometry (n=3) in control and PP2Ac knockdown Tregs. (C) FACS gating strategy for pSTAT5 activation analysis. Tregs transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency. Numbers represent MFI of PP2Ac for the indicated cell population. (D) IL-2-induced pSTAT5 dose-response curves (left) for the indicated group of Tregs shown in Fig. 7C (n=6). Nonlinear regression analysis of the binding data (middle) was used to determine EC50 (right) (E) Representative histograms (left) and quantitative evaluation (right) of pSTAT5 MFI for indicated cell population after treatment with 40 and 400 pM of IL-2 (n=6). The numbers represent MFI of the gated pSTAT5+ cells. (F) Representative histograms of IL-2R subunit expression on control and PP2Ac shRNA transduced Tregs. Data (B-E) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B, D-E) or an unpaired two-tailed t test (D).*P < 0.05, **P < 0.01, ***P<0.001, ****P<0.0001, ns, not significant;

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Transduction, shRNA, Expressing, Western Blot, Flow Cytometry, Activation Assay, Binding Assay, Two Tailed Test

Overexpression and knockdown of PP2Ac does not alter pSTAT5 response to IL-2 by human Teff cells. (A-B) Expression of PP2Ac in freshly isolated Treg and TEM cells were assessed using Western blotting (n=3) (A) and flow cytometry (n=3) (B). (C) Quantification of the enzymatic activity of PP2A in freshly isolated Treg and TEM cells (n=3). (D, E) Transduction efficiency in vector-transduced and PP2Ac-overexpressed Teff cells (D) or in control and PP2Ac shRNA-transduced cells (E) was assessed by the percentage of GFP+ cells. (F, G) PP2Ac expression in control and PP2Ac-transduced overexpressed cells (F) or in control and PP2Ac shRNA knockdown cells (G) was assessed by flow cytometry (n=3). Teff cells transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency and this gating strategy was used for pSTAT5 analysis in Fig. 8K. (H, I) Representative histograms for CD25 expression for control and PP2Ac-overexpressed (H) or for control and PP2Ac shRNA transduced Teff cells (I). The numbers in the FACS plots are the MFI of CD25 for the indicated cell populations. (J, K) IL-2-induced pSTAT5 dose-response curves (left) of control and PP2Ac-overexpressed (J) or control and PP2Ac shRNA transduced Teff cells (K). Nonlinear regression analysis of the binding data (middle) was performed to determine EC50 (right) (n=3). Data (A-C, F, G, J, K) are shown as the means ± SEM and were analyzed by a one-sample two-tailed t test (A-C, F, J, K).. *P < 0.05; ***P < 0.001; ns, not significant.

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression and knockdown of PP2Ac does not alter pSTAT5 response to IL-2 by human Teff cells. (A-B) Expression of PP2Ac in freshly isolated Treg and TEM cells were assessed using Western blotting (n=3) (A) and flow cytometry (n=3) (B). (C) Quantification of the enzymatic activity of PP2A in freshly isolated Treg and TEM cells (n=3). (D, E) Transduction efficiency in vector-transduced and PP2Ac-overexpressed Teff cells (D) or in control and PP2Ac shRNA-transduced cells (E) was assessed by the percentage of GFP+ cells. (F, G) PP2Ac expression in control and PP2Ac-transduced overexpressed cells (F) or in control and PP2Ac shRNA knockdown cells (G) was assessed by flow cytometry (n=3). Teff cells transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency and this gating strategy was used for pSTAT5 analysis in Fig. 8K. (H, I) Representative histograms for CD25 expression for control and PP2Ac-overexpressed (H) or for control and PP2Ac shRNA transduced Teff cells (I). The numbers in the FACS plots are the MFI of CD25 for the indicated cell populations. (J, K) IL-2-induced pSTAT5 dose-response curves (left) of control and PP2Ac-overexpressed (J) or control and PP2Ac shRNA transduced Teff cells (K). Nonlinear regression analysis of the binding data (middle) was performed to determine EC50 (right) (n=3). Data (A-C, F, G, J, K) are shown as the means ± SEM and were analyzed by a one-sample two-tailed t test (A-C, F, J, K).. *P < 0.05; ***P < 0.001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Expressing, Isolation, Western Blot, Flow Cytometry, Activity Assay, Transduction, Plasmid Preparation, shRNA, Binding Assay, Two Tailed Test

Effect of okadaic acid (OA; 10 −9 M) on corticosteroid sensitivity (A), GR nuclear translocation (B), phosphorylation levels of GR-Ser 226 (C) and JNK1 (D) in U937 cells (n = 3–4). E: Effect of PP2A siRNA on IC 50 of dexamethasone on TNFα-induced IL-8 (n = 7). Values represent means ± SEM. # P <0.05, ## P <0.01 (vs. non-treatment control; NT), * P <0.05.

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: Effect of okadaic acid (OA; 10 −9 M) on corticosteroid sensitivity (A), GR nuclear translocation (B), phosphorylation levels of GR-Ser 226 (C) and JNK1 (D) in U937 cells (n = 3–4). E: Effect of PP2A siRNA on IC 50 of dexamethasone on TNFα-induced IL-8 (n = 7). Values represent means ± SEM. # P <0.05, ## P <0.01 (vs. non-treatment control; NT), * P <0.05.

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Translocation Assay

Effects of IL-2/IL-4 co-treatment for 48 h on IC 50 of dexamethasone on TNFα-induced IL-8 release (A), PP2A C protein expression (B), immunoprecipitated PP2A (IP-P2A) activity (C), PP2A C -Tyr 307 phosphorylation(D), GR-Ser 226 phosphorylation (E) and JNK1 phosphorylation (F). Values represent means ± SEM (n = 3–4). # P <0.05, ## P <0.01 (vs. non-treatment control; NT).

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: Effects of IL-2/IL-4 co-treatment for 48 h on IC 50 of dexamethasone on TNFα-induced IL-8 release (A), PP2A C protein expression (B), immunoprecipitated PP2A (IP-P2A) activity (C), PP2A C -Tyr 307 phosphorylation(D), GR-Ser 226 phosphorylation (E) and JNK1 phosphorylation (F). Values represent means ± SEM (n = 3–4). # P <0.05, ## P <0.01 (vs. non-treatment control; NT).

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Expressing, Immunoprecipitation, Activity Assay

PP2A C protein expression (A), PP1 protein expression (B), immunoprecipitated PP2A (IP-PP2A) activity (C), phosophorylation levels of GR-Ser 226 (D) and PP2A C -Tyr 307 (F) in PBMCs from severe asthmatics (SA) and healthy volunteers (HV). E. Correlation between PP2A C expression and GR-Ser 226 phosphorylation. The dotted lines show 95% confidence interval. # P <0.05, ## P <0.01 (vs. HV).

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: PP2A C protein expression (A), PP1 protein expression (B), immunoprecipitated PP2A (IP-PP2A) activity (C), phosophorylation levels of GR-Ser 226 (D) and PP2A C -Tyr 307 (F) in PBMCs from severe asthmatics (SA) and healthy volunteers (HV). E. Correlation between PP2A C expression and GR-Ser 226 phosphorylation. The dotted lines show 95% confidence interval. # P <0.05, ## P <0.01 (vs. HV).

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Expressing, Immunoprecipitation, Activity Assay

(A) PP2A C and JNK1 expression in GR-immunoprecipitates. Expression levels of PP2A C in GR (B)- or JNK1 (D)-immunoprecipitates. PP2A activity in GR (C)- and JNK1 (E) immunoprecipitates were also determined. Values represent means of four experiments ± SEM. # P <0.05, ## P <0.01 (vs. non-treatment control; NT).

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: (A) PP2A C and JNK1 expression in GR-immunoprecipitates. Expression levels of PP2A C in GR (B)- or JNK1 (D)-immunoprecipitates. PP2A activity in GR (C)- and JNK1 (E) immunoprecipitates were also determined. Values represent means of four experiments ± SEM. # P <0.05, ## P <0.01 (vs. non-treatment control; NT).

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Expressing, Activity Assay

SP-induced association of NK1R, β-arrestin-1 (βARR1), and protein phosphatase 2A (PP2A). A and B: HEK-NK1R cells transfected with βARR1-green fluorescent protein (GFP) and hemagglutinin (HA)-PP2A were incubated with SP (10 nM, 0–10 min). SP induced redistribution of βARR1-GFP and HA-PP2A from the cytosol (arrows) to the plasma membrane (arrowheads) (A). Quantification indicated that SP significantly increased plasma membrane βARR1 and PP2A (B). C: HEK-NK1R cells were incubated with SP. Endogenous PP2A was immunoprecipitated (IP) and Western blotted (WB) for endogenous βARR1. D and E: HEK-NK1R cells were incubated with SP (10 nM, 0–10 min), and association of NK1R with endogenous βARR1 or PP2A was determined by proximity ligation assay (PLA). The total number of PLA signals (red) was divided by the number of nuclei (blue) to calculate PLA signals per cell. SP significantly increased PLA signals for NK1R with βARR1 and PP2A. F and G: controls for PLA. Cells were incubated with SP (10 nM, 10 min), and association of NK1R with endogenous βARR1 or PP2A was determined by PLA. In HEK-NK1R cells (F), there were no detected PLA signals when primary antibodies were omitted. In HEK-FLP cells lacking NK1R (G), there were no PLA signals for NK1R and βARR1 (top) nor NK1R and PP2A (bottom). Scale, 10 μm. (n = 3–5 experiments, >10 images analyzed per experiment.) *P < 0.05.

Journal: American Journal of Physiology - Cell Physiology

Article Title: Protein phosphatase 2A mediates resensitization of the neurokinin 1 receptor

doi: 10.1152/ajpcell.00096.2011

Figure Lengend Snippet: SP-induced association of NK1R, β-arrestin-1 (βARR1), and protein phosphatase 2A (PP2A). A and B: HEK-NK1R cells transfected with βARR1-green fluorescent protein (GFP) and hemagglutinin (HA)-PP2A were incubated with SP (10 nM, 0–10 min). SP induced redistribution of βARR1-GFP and HA-PP2A from the cytosol (arrows) to the plasma membrane (arrowheads) (A). Quantification indicated that SP significantly increased plasma membrane βARR1 and PP2A (B). C: HEK-NK1R cells were incubated with SP. Endogenous PP2A was immunoprecipitated (IP) and Western blotted (WB) for endogenous βARR1. D and E: HEK-NK1R cells were incubated with SP (10 nM, 0–10 min), and association of NK1R with endogenous βARR1 or PP2A was determined by proximity ligation assay (PLA). The total number of PLA signals (red) was divided by the number of nuclei (blue) to calculate PLA signals per cell. SP significantly increased PLA signals for NK1R with βARR1 and PP2A. F and G: controls for PLA. Cells were incubated with SP (10 nM, 10 min), and association of NK1R with endogenous βARR1 or PP2A was determined by PLA. In HEK-NK1R cells (F), there were no detected PLA signals when primary antibodies were omitted. In HEK-FLP cells lacking NK1R (G), there were no PLA signals for NK1R and βARR1 (top) nor NK1R and PP2A (bottom). Scale, 10 μm. (n = 3–5 experiments, >10 images analyzed per experiment.) *P < 0.05.

Article Snippet: Antibodies were from the following sources: monoclonal rat anti-human PP2A, rabbit anti-PP2A, and biotin-labeled goat anti-human ECE-1 from R&D Systems (Wiesbaden, Germany); rabbit anti-βARR1 from Abcam (München, Germany); mouse anti-βARR1 and mouse anti-PP2A catalytic subunit from BD Transduction Laboratories (San Jose, CA); rat high-affinity anti-hemagglutinin 11 (HA11) from Roche Applied Science (Indianapolis, IN); mouse anti-HA11 from Covance (Princeton, NJ); rabbit anti-NK 1 R 94168 ( 13 ).

Techniques: Transfection, Incubation, Membrane, Immunoprecipitation, Western Blot, Proximity Ligation Assay

SP-induced trafficking of βARR1, PP2A, and NK1R. HEK-NK1R cells expressing βARR1-GFP and HA-PP2A were incubated with SP (10 nM, 0–10 min), washed, and recovered for 10–60 min. A: in unstimulated cells, βARR1 and PP2A were similarly distributed in the cytosol (arrows) and NK1R was at the plasma membrane (arrowheads). After 10 min with SP, βARR1 and PP2A were detected with NK1R at the plasma membrane (arrowheads). B: after 10 min recovery, βARR1 colocalized with NK1R in endosomes (arrows), although some NK1R remained at the plasma membrane. After 60 min recovery, βARR1, PP2A, and NK1R were detected at the plasma membrane (arrowheads). Inhibition of ECE-1 with SM-19712 caused retention of βARR1 and NK1R in endosomes (arrows), preventing accumulation of βARR1 and PP2A at the plasma membrane. Scale, 10 μm.

Journal: American Journal of Physiology - Cell Physiology

Article Title: Protein phosphatase 2A mediates resensitization of the neurokinin 1 receptor

doi: 10.1152/ajpcell.00096.2011

Figure Lengend Snippet: SP-induced trafficking of βARR1, PP2A, and NK1R. HEK-NK1R cells expressing βARR1-GFP and HA-PP2A were incubated with SP (10 nM, 0–10 min), washed, and recovered for 10–60 min. A: in unstimulated cells, βARR1 and PP2A were similarly distributed in the cytosol (arrows) and NK1R was at the plasma membrane (arrowheads). After 10 min with SP, βARR1 and PP2A were detected with NK1R at the plasma membrane (arrowheads). B: after 10 min recovery, βARR1 colocalized with NK1R in endosomes (arrows), although some NK1R remained at the plasma membrane. After 60 min recovery, βARR1, PP2A, and NK1R were detected at the plasma membrane (arrowheads). Inhibition of ECE-1 with SM-19712 caused retention of βARR1 and NK1R in endosomes (arrows), preventing accumulation of βARR1 and PP2A at the plasma membrane. Scale, 10 μm.

Article Snippet: Antibodies were from the following sources: monoclonal rat anti-human PP2A, rabbit anti-PP2A, and biotin-labeled goat anti-human ECE-1 from R&D Systems (Wiesbaden, Germany); rabbit anti-βARR1 from Abcam (München, Germany); mouse anti-βARR1 and mouse anti-PP2A catalytic subunit from BD Transduction Laboratories (San Jose, CA); rat high-affinity anti-hemagglutinin 11 (HA11) from Roche Applied Science (Indianapolis, IN); mouse anti-HA11 from Covance (Princeton, NJ); rabbit anti-NK 1 R 94168 ( 13 ).

Techniques: Expressing, Incubation, Membrane, Inhibition

ECE-1-dependent interactions of cell-surface NK1R with βARR1 and PP2A. A. Schematic showing method used to specifically immunoprecipitate only cell-surface NK1R. Intact cells were incubated with antibody to extracellular Flag at 4°C, before cell lysis and isolation of NK1R immune complexes using protein A/G beads. B–D: HEK-NK1R cells were incubated with SP (10 nM, 10 min) or vehicle, washed, and recovered. Cell-surface NK1R was immunoprecipitated and Western blotted, and blots were probed for endogenous βARR1 or PP2A, or for NK1R. Stimulation with SP significantly increased interaction of surface NK1R with βARR1 (B) and PP2A (C). Inhibition of ECE-1 with SM-19712 inhibited these interactions. βARR1 small interfering RNA (siRNA) knockdown (D) abolished interactions. (n = 3 experiments.) E: siRNA to βARR1 reduced expression of βARR1 in HEK-NK1R cells, determined by Western blotting compared with control siRNA. *P < 0.05.

Journal: American Journal of Physiology - Cell Physiology

Article Title: Protein phosphatase 2A mediates resensitization of the neurokinin 1 receptor

doi: 10.1152/ajpcell.00096.2011

Figure Lengend Snippet: ECE-1-dependent interactions of cell-surface NK1R with βARR1 and PP2A. A. Schematic showing method used to specifically immunoprecipitate only cell-surface NK1R. Intact cells were incubated with antibody to extracellular Flag at 4°C, before cell lysis and isolation of NK1R immune complexes using protein A/G beads. B–D: HEK-NK1R cells were incubated with SP (10 nM, 10 min) or vehicle, washed, and recovered. Cell-surface NK1R was immunoprecipitated and Western blotted, and blots were probed for endogenous βARR1 or PP2A, or for NK1R. Stimulation with SP significantly increased interaction of surface NK1R with βARR1 (B) and PP2A (C). Inhibition of ECE-1 with SM-19712 inhibited these interactions. βARR1 small interfering RNA (siRNA) knockdown (D) abolished interactions. (n = 3 experiments.) E: siRNA to βARR1 reduced expression of βARR1 in HEK-NK1R cells, determined by Western blotting compared with control siRNA. *P < 0.05.

Article Snippet: Antibodies were from the following sources: monoclonal rat anti-human PP2A, rabbit anti-PP2A, and biotin-labeled goat anti-human ECE-1 from R&D Systems (Wiesbaden, Germany); rabbit anti-βARR1 from Abcam (München, Germany); mouse anti-βARR1 and mouse anti-PP2A catalytic subunit from BD Transduction Laboratories (San Jose, CA); rat high-affinity anti-hemagglutinin 11 (HA11) from Roche Applied Science (Indianapolis, IN); mouse anti-HA11 from Covance (Princeton, NJ); rabbit anti-NK 1 R 94168 ( 13 ).

Techniques: Incubation, Lysis, Isolation, Immunoprecipitation, Western Blot, Inhibition, Small Interfering RNA, Expressing

Role of PP2A in NK1R resensitization. HEK-NK1R cells were incubated with SP (10 nM, 10 min) or vehicle, washed, and challenged with SP (10 nM) at 30 or 60 min recovery. PP2A inhibitors fostriecin and okadaic acid inhibited resensitization compared with vehicle. (n = 4–8 experiments in triplicate.) *P < 0.05.

Journal: American Journal of Physiology - Cell Physiology

Article Title: Protein phosphatase 2A mediates resensitization of the neurokinin 1 receptor

doi: 10.1152/ajpcell.00096.2011

Figure Lengend Snippet: Role of PP2A in NK1R resensitization. HEK-NK1R cells were incubated with SP (10 nM, 10 min) or vehicle, washed, and challenged with SP (10 nM) at 30 or 60 min recovery. PP2A inhibitors fostriecin and okadaic acid inhibited resensitization compared with vehicle. (n = 4–8 experiments in triplicate.) *P < 0.05.

Article Snippet: Antibodies were from the following sources: monoclonal rat anti-human PP2A, rabbit anti-PP2A, and biotin-labeled goat anti-human ECE-1 from R&D Systems (Wiesbaden, Germany); rabbit anti-βARR1 from Abcam (München, Germany); mouse anti-βARR1 and mouse anti-PP2A catalytic subunit from BD Transduction Laboratories (San Jose, CA); rat high-affinity anti-hemagglutinin 11 (HA11) from Roche Applied Science (Indianapolis, IN); mouse anti-HA11 from Covance (Princeton, NJ); rabbit anti-NK 1 R 94168 ( 13 ).

Techniques: Incubation

S100A8/A9 proteins augment differentiation and osteoclastic activity derived from iOCPs but not from hOCPs. a Expression of S100A8, S100A9 and RAGE in sorted control and inflamed BM iOCPs and hOCPs. The protein phosphatase 2A catalytic subunit (PP2Ac) is shown as a loading control. b Densitometry measurements of three biological repeats (no statistical analysis presented). c Sorted control and inflamed BM iOCPs and hOCPs (5 × 10 4 ) were cultured on the Osteo assay surface with or without anti-RAGE blocking antibodies (bar: 50 µm). d Pit area quantitation. e Sorted iOCPs and hOCPs (5 × 10 4 ) from the BM of control mice were cultured on the Osteo assay surface in combination with a recombinant S100A8/A9 heterodimer and anti-RAGE blocking antibodies as indicated (bar: 50 µm). f Pit area quantitation. c – f Depict representative results for two independent experiments, n = 5 for each group. Line: median, box: 25th-75th percentile, whiskers: range. * P < 0.05 (Mann–Whitney test and Holm multiplicity correction)

Journal: Bone Research

Article Title: Specific inflammatory osteoclast precursors induced during chronic inflammation give rise to highly active osteoclasts associated with inflammatory bone loss

doi: 10.1038/s41413-022-00206-z

Figure Lengend Snippet: S100A8/A9 proteins augment differentiation and osteoclastic activity derived from iOCPs but not from hOCPs. a Expression of S100A8, S100A9 and RAGE in sorted control and inflamed BM iOCPs and hOCPs. The protein phosphatase 2A catalytic subunit (PP2Ac) is shown as a loading control. b Densitometry measurements of three biological repeats (no statistical analysis presented). c Sorted control and inflamed BM iOCPs and hOCPs (5 × 10 4 ) were cultured on the Osteo assay surface with or without anti-RAGE blocking antibodies (bar: 50 µm). d Pit area quantitation. e Sorted iOCPs and hOCPs (5 × 10 4 ) from the BM of control mice were cultured on the Osteo assay surface in combination with a recombinant S100A8/A9 heterodimer and anti-RAGE blocking antibodies as indicated (bar: 50 µm). f Pit area quantitation. c – f Depict representative results for two independent experiments, n = 5 for each group. Line: median, box: 25th-75th percentile, whiskers: range. * P < 0.05 (Mann–Whitney test and Holm multiplicity correction)

Article Snippet: For the detection of RAGE and PP2Ac, membranes were blocked with 5% BSA in TBST and probed with an anti-RAGE (Abcam, Cat#: Ab3611) or anti-PP2Ac (R&D, Cat#: AF1653) antibody, followed by incubation with peroxidase-conjugated donkey anti-rabbit IgG (BioLegend, Cat#: 406401).

Techniques: Activity Assay, Derivative Assay, Expressing, Cell Culture, Blocking Assay, Quantitation Assay, Recombinant, MANN-WHITNEY